Copyright
Science Protein biosynthesis
Question:
Does transcription go in the 3' - 5' direction or 5' - 3' direction?
Transcription:
Transcription is the first step in protein synthesis where a gene on DNA is copied into a strand of mRNA by RNA polymerase enzymes.
Directionality of Transcription:
- The chemical structure of DNA determines how base pairs can be added to an elongating RNA strand during transcription.
- On the 5' end of the DNA is a carbon atom bound to a phosphate group. This molecule is not available to form bonds with other atoms.
- The 3' end of the DNA strand contains a carbon atom bound to a hydroxyl group (-OH). This group can form bonds with other atoms through a process called dehydration synthesis. This reaction attaches new molecules and releases water as a result.
Answer and Explanation:1
Transcription always occurs in the 5' - 3' direction because it must be antiparallel to the complementary strand it is base paired with. So that means it will start at the 3' end of its complementary strand and proceed in the 5' - 3' direction as it copies the gene on DNA into mRNA.
Become a member and unlock all StudyAnswers
Start today. Try it now
Create an account
Ask a question
Our experts can answer your tough homework and study questions.
Search Answers
Learn more about this topic:
Get access to this video and our entire Q&A library
Try it now
mRNA Transcription Process & Phases
from
Chapter 9/ Lesson 2
65K
Learn about mRNA transcription. Discover where and how DNA is transcribed into RNA in prokaryotes and eukaryotes, and examine the final product of transcription.
Related to this Question
- Explain the main steps of transcription .
- Explain transcription and translation.
- How does transcription occur, and what are its steps and directionality?
- What are the basic steps of transcription and translation?
- Relating to biology, explain the term 'reverse transcription'.
- What are the basics of transcription and translation?
- How does transcription occur? Describe its steps and directionality.
- What are transcription and translation? Explain in detail.
- List the 3 stages of Transcription.
- Define transcription and translation.
- Define translation and transcription.
- Transcription occurs in the ______. Translation occurs in the ______.
- What does transcription do?
- _________ is the location that the protein _________ begins transcription and _________ is the location that it ends transcription.
- RNA polymerase: a. reads the template strand of the DNA in the 3' to 5' direction. b. synthesizes the RNA in the 5' to 3' direction. c. can begin transcription without a primer. d. All of the above are correct.
- Explain the differences between transcription and translation.
- What is the difference between the process of translation and transcription?
- DNA has directionality which means that the genes are oriented in one direction, and RNA is transcribed in that direction. This direction is ______ to ________.
- Describe the process of transcription.
- Describe and explain what is meant by transcription and translation.
- What is transcription?
- What is the difference between transcription and translation in biology?
- Which direction is the template DNA read by the RNA polymerase? A.upstream B.downstream C.3'-> 5'
- Which direction is the template DNA read by the RNA polymerase?
- Which of the following processes can proceed in both the 5' to 3' direction and the 3' to 5' direction? a. DNA gap repair. b. DNA transcription. c. DNA translation. d. DNA proofreading. e. None of the above.
- Give the differences between Translation and Transcription.
- Transcribe this piece of DNA: 5 TTCATACCCGTTACGACATT 3
- Explain the process of DNA transcription and translation.
- Transcription happens (in the nucleus/out of the nucleus).
- RNA grows in the _____ direction, as RNA polymerase moves along the template DNA strand in the _____ direction.
- What is the difference between translation and transcription?
- Relating to biology, explain the term 'transcription'.
- What is the point of transcription? Why is transcription needed?
- Define transcription.
- What direction does RNA replicate? How many amino acids are in translation and transcription?
- Transcribe this gene
- Briefly describe what happens during transcription.
- DNA replication occurs in the direction.
- Transcription is reading (DNA/RNA) and making a copy of that information in (DNA/RNA).
- What is the main difference between transcription and translation?
- Elongation of the DNA strand proceeds in the _____ direction.
- Only one strand of DNA is used during transcription. Why?
- If you have a double-stranded DNA molecule, how do you determine which strand is the template strand for transcription and in which direction?
- Identify the steps of the processes of transcription and translation.
- Messenger RNA is synthesized in a (Blank) direction. Therefore, during transcription the DNA template strand is read in a (Blank) direction.
- In what direction is DNA read? As in, is it 3'- 5'? Why?
- What are translation and transcription in genetics?
- What is transcription and what does it involve?
- Where in the cell does transcription take place?
- What happens to the DNA after transcription?
- Describe the process of translation and transcription in the cell.
- Can mRNA be changed after transcription?
- What does transcription produce?
- What signals the end of transcription?
- What are the three stages of the transcription process?
- Describe the three stages of Transcription in detail.
- Define transcription factor.
- What is the product of transcription?
- What controls the transcription of a gene?
- How can repressors interfere with transcription?
- Please explain replication, transcription, and translation.
- Give the product of transcription.
- What are the differences between the processes of translation and transcription?
- What is the process of transcription and translation within biology? What are some examples?
- What is involved with the initiation of transcription?
- What is the direction of lagging strand synthesis?
- What is the difference between transcription and translation? Where in the cell do they occur?
- What are the differences between translation and transcription?
- The DNA sequence __5'ACCGTTAGCCA__ would be transcribed as?
- What direction does reverse transcriptase synthesize DNA?
- Why does RNA polymerase always build a new RNA in 5 to 3 directions in a transcription?
- How is a transcription unit made up of genetics?
- Relating to biology, explain the term 'transcription unit'.
- What is the differences between translation and transcription in biology?
- 1. What is transcription? 2. What is translation?
- How does the transcription of DNA to RNA work?
- Describe the steps of transcription and translation in a eukaryotic cell.
- What are the main differences between translation and transcription?
- Transcribe the following DNA sequence into mRNA: 5 -TACGATTGCTATGCCATC-3
- Describe the transcription and translation that happens during protein synthesis.
- Explain about the different steps involved in gene transcription process.
- Describe transcription, translation, and the genetic code.
- What is the elongation stage of transcription?
- Using the new strand as the reference, in which direction does DNA synthesis always occur? a. 5' to 3' b. 3' to 5' c. either direction d. toward the histone
- Write a short note on the process of transcription.
- What are transcription factors?
- The DNA sequence __5' ATTGC 3'__ would transcribe as?
- In replication, in which direction would the lagging strand of the new DNA strand be going?
- Transcription/Translation: Consider the gene below: 3' 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 5' T A C C C T T A A C C A A T G A G T A T T 5' A T G G G A A T T G G T T A C T C A T A A 3' 1. In the space below, write the nucleotide sequence
- How does transcription take place in prokaryotes?
- Describe two differences between transcription and translation.
- In what way does DNA methylation typically regulate transcription? a) It doesn't regulate transcription at all. b) Activates transcription. c) Represses transcription. d) a and b.
- Explain transcription and how the pre-mRNA is processed.
- The process of transcription. a. Can only produce messenger RNA molecules. b. Builds an RNA strand in the 5' to 3' direction. c. Occurs only in eukaryote cells. d. Takes place on ribosomes.
- Explain the roles of transcription and translation in converting the DNA message to a protein.
- In what direction chemically speaking is a DNA strand constructed? - 5' to 3' direction - 3' to 5' direction - right - left - up - down - antiparallel
- Transcribe a template strand of DNA into an RNA strand with correct base pairing and directionality. (Keep in mind the direction in which DNA is transcribed)
- How does Central Dogma differ from transcription?
- Describe the basics of transcription and translation. Where in human cells does each of these processes occur?
- Why does a cell need to carry out transcription before translation?
Explore our homework questions and answers library
Browseby subject
- Math
- Social Sciences
- Science
- Business
- Humanities
- History
- Art and Design
- Tech and Engineering
- Health and Medicine
Ask a Question
To ask a site support question,click here